Abcc8^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGCACATATGAGACGCA and CTGCAGGCCGGTCCTAAGCA, which resulted in a 406 bp deletion beginning at Chromosome 7 position 46,178,322 bp and ending after 46,178,727 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001040856 (exon 2) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 50. (J:188991)