Ascl4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCTGAGTGGGATTAGAAG and CATTCAGCTCAAATGCCAAA, which resulted in a 2177 bp deletion beginning at Chromosome 10 position 85,927,535 bp and ending after 85,929,711 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000912627 (exon 1) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)