This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTTTGTAACCAGTGACCG and ATACGCTTTGTCCTGCAGCA, which resulted in a 424 bp deletion beginning at Chromosome 18 position 58,582,070 bp and ending after 58,582,493 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362415(exon 4) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 281 and early truncation 19 amino acids later. (J:188991)