4930579F01Rik^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTTAATAGAGCTGTAAAA and GTTTCCTCACATGCACACAT, which resulted in a 322 bp deletion beginning at Chromosome 3 position 138,179,375 bp and ending after 138,179,696 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240313 (exon 3) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 1 amino acid later. (J:188991)