Usp35^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTACTTATATCTATCCCA and CCAGCATGAACTCTTCCGAA, which resulted in a 429 bp deletion beginning at Chromosome 7 position 97,324,102 bp and ending after 97,324,530 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000906983 (exon 2) and 296 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 1 amino acid later. (J:188991)