This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACACGCTAAAGAATCTTAT and GACATTCGCAGACCTTCCAA, which resulted in a 398 bp deletion beginning at Chromosome 3 position 134,861,032 bp and ending after 134,861,429 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000176975 (exon 3) and 247 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 233 and early truncation 1 amino acid later. (J:188991)