This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGAATCAGGTTAACCAAG and ATTATAGTAGTCATGGTGAA, which resulted in a 738 bp deletion beginning at Chromosome 11 position 67,328,779 bp and ending after 67,329,516 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578946 and ENSMUSE00001022684 (exons 2 and 3) and 437 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 7 amino acids later. (J:188991)