This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCTAACATGGGAAGCACA and ATACAGGTCAGAGGATGTGG, which resulted in a 439 bp deletion beginning at Chromosome 4 position 155,731,135 bp and ending after 155,731,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184815 (exon 3) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 23 amino acids later. (J:188991)