Stoml1^em1(IMPC)Tcp

This allele from project TCPR1220 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGTGTTGTACCGGTTAGTTA and CACCGTGTCCCAGAGTACAG targeting the 5' side and CTTGTGAGAAGCCACCTACC and GGCCCTCATTCAAAGAGACC targeting the 3' side of a critical exon. This resulted in a 2444-bp del Chr9: 58254845 to 58257288 (GRCm38). (J:265051)