Zbtb44^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATCTAAAAAGCAGCCT and CCCCCATACAACAACCCTGA, which resulted in a 404 bp deletion beginning at Chromosome 9 position 31,063,974 bp and ending after 31,064,377 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000413910 (exon 4) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 368 and early truncation 1 amino acid later. In addition, there is a 23 bp insertion (ACTGTAGGAACTGATGAGAGTTG) at the deletion site. (J:188991)