Tmem164^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTGCGAGAAGTGACCCT and TTACACTTCAGCTACAGCAA, which resulted in a 340 bp deletion beginning at Chromosome X position 142,770,892 bp and ending after 142,771,231 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001301823 (exon 4) and 273 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 5 amino acids later. (J:188991)