Wdr70^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGGGATCTTGTGATACA and CATCTGGAATGGAATCCCCC, which resulted in a 453 bp deletion beginning at Chromosome 15 position 8,082,304 bp and ending after 8,082,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000564027 (exon 4) and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 20 amino acids later. (J:188991)