This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AATTAAGCATTAAAGGCCAA and TTATCAGCAAAAAAAGCTGA, which resulted in a 562 bp deletion beginning at Chromosome 2 position 125,773,086 bp and ending after 125,773,647 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324940 (exon 3) and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 4 amino acids later. (J:188991)