This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTAGCCAGACAGCATGCC and ATCTCTACAGTGCTGTAAAT, which resulted in a 581 bp deletion beginning at Chromosome 1 position 134,902,144 bp and ending after 134,902,724 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237379 (exon 2) and 450 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 3 amino acids later. (J:188991)