This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGATATGCTGAACAGTAC and GTAAGTATTCTTGCTTTCAA, which resulted in a 476 bp deletion beginning at Chromosome 16 position 20,114,420 bp and ending after 20,114,895 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130712 (exon 4) and 291 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 307 and early truncation 6 amino acids later. (J:188991)