Sh3rf3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCATCCCAAGGTCAACA and GAGAATGTCGACAGACATGA, which resulted in a 361 bp deletion beginning at Chromosome 10 position 59,071,696 bp and ending after 59,072,056 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001288805 (exon 5) and 256 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 428 and early truncation 12 amino acids later. (J:188991)