electroporating Cas9 protein and 2 guide sequences GGGAGGGAACCACTGTCCCG and CTAGCTGAGGATATGTCCCC, which resulted in a 250 bp deletion beginning at Chromosome 4 position 139,607,520 bp and ending after 139,607,769 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001229038 (exon 5) and 110 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 316 and early truncation 4 amino acids later. (J:188991)