This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCCAGCTAAGACTTGAGT and TTCAGGGTACACGTTATCAA, which resulted in an 861 bp deletion beginning at Chromosome 16 position 17,776,376 bp and ending after 17,777,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130069 (exon 4) and 142 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 131 and early truncation 1 amino acid later. (J:188991)