This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTGTGGTGGAAGAGACG and CCGCAAGTCACAACAAATCA, which resulted in an 898 bp deletion beginning at Chromosome 1 position 36,357,760 bp and ending after 36,358,657 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000156007, ENSMUSE00000155996 (exons 4 and 5) and 621 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 3 amino acids later. (J:188991)