Dnah2^em1(IMPC)Tcp

This allele from project TCPR1073 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGTCACACTAACCACCCCA and TGTTCTGGGCCGCAGGCACT targeting the 5' side and CAAATGCGTATAACCAGCGA and ATCACTACTCACGGTCACAA targeting the 3' side of a critical exon. This resulted in a 1295-bp deletion of Chr11 from 69483130 to 69484424 (GRCm38). (J:265051)