This allele from project TCPR1077 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGATGTGCATATTTCCACG targeting the 5' side and GCAGCACTAAGATATATGAC targeting the 3' side of a critical region. This resulted in a 118-bp del Chr6:13876025 to 13876142; predicted p.H139Lfs*46 (GRCm38). (J:265051)