This allele from project TCPR1079 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGCAAGGACTGAAGTCTCG and TACGCGTGATACTCTGCCCT targeting the 5' side and ACTTATGTGGTCAAACTTCA and TTTTCTGGGTGTTAGGCACG targeting the 3' side of a critical region. This resulted in a 4-del Chr5:93154667 to 93154670_insTAAGTGCCAGGGATTCTTA and 471_bp del Chr5:93154760 to 93155230 (GRCm38). (J:265051)