This allele from project TCPR1074 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGGTTGGAATCGTGCTGTC and CGTTCCCTGAGGTAGTCCTA targeting the 5' side and CAAGTGAGGAGAACTGCGTG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion of Chr18 from 75082183 to 75082187 and a 309-bp deletion of Chr18 from 75082260 to 75082568 (GRCm38). (J:265051)