This allele from project TCPR1205 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTACCCGTGCCACATCCTTG and GGCACTGTGTCCCGCTGCGA targeting the 5' side and CCATTCAGCATGGGTCCCGT and ATGCGTATTATGACCCGCCT targeting the 3' side of a critical exon. This resulted in a 24-bp indel Chr14: 55543596 to 55543619 and 252-bp del Chr14: 55543654 to 55543905, p.(A122_V129del, S142Hfs*21 resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:265051)