This allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele resulted from non-homologous end-joining repair and a 2-bp deletion from Chr4:141595338 to 141595339 in exon OTTMUSE00000117321. This mutation is predicted to cause a frameshift with amino acid changes after residue 40 and early truncation 51 amino acids later (p.A40Sfs*53). (GRCm38). (J:265051)