Ing5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACAGGTGACTTCCGTAAG and GCTGCCTTCCGTGCCCCTGA, which resulted in a 432 bp deletion beginning at Chromosome 1 position 93,811,567 bp and ending after 93,811,998 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000282247 (exon 3) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 2 amino acids later. (J:188991)