Naip2^em1Vnce

Single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) of the gene resulting in a 4 bp frameshift deletion. The deletion is predicted to result in NAIP proteins truncated before the NBD (a domain essential for NAIP). (J:233320)