Fam53c^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGCATTTTTGAGGAGGAG and GTTAAAATTCAATACTGCCA, which resulted in a 1151 bp deletion beginning at Chromosome 18 position 34,767,928 bp and ending after 34,769,078 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000483922 (exon 4) and 366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 27 amino acids later. (J:188991)