This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTAACTTAGACACAGCACG and TTAGACTTGAGGGTATCTCG, which resulted in a 1279 bp deletion beginning at Chromosome 8 position 113,638,301 bp and ending after 113,639,579 bp bp (GRCm38/mm10). This mutation deletes ENSMUSE00000305362 (exon 3) and 454 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 164 and early truncation 3 amino acids later. (J:188991)