Ccsap^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTGGACTTTGGTTAACTG and GATAGCGATGGTGACTCCTG, which resulted in a 707 bp deletion beginning at Chromosome 8 position 123,845,017 bp and ending after 123,845,723 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215358 (exon 2) and 441 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 2 amino acids later. (J:188991)