Cmya5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGTTTCAGCACTCGACA and GTTATCAGATGAGGATGAGG, which resulted in a 9281 bp deletion beginning at Chromosome 13 position 93,089,133 bp and ending after 93,098,413 bp (GRCm38/mm10). This mutation deletes 9281 bp from ENSMUSE00000356892 (exon 2) and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 3 amino acids later. (J:188991)