This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTTGAAACTTTTGCCA and AAGTTAGTTTTCTAATTCTT, which resulted in a 544 bp deletion beginning at Chromosome 8 position 8,683,487 bp and ending after 8,684,030 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000638285 (exon 2) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 113 and early truncation 14 amino acids later. In addition, there is a 5 bp insertion (ACCTG) at the deletion site. (J:188991)