Dync1li2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTGCCCATGAAGTCAACA and AAAGCATCTATGCATGGCAG, which resulted in a 490 bp deletion beginning at Chromosome 8 position 104,430,198 bp and ending after 104,430,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000228453 (exon 5) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 176 and early truncation 1 amino acid later. (J:188991)