This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAAACATTTTTCTAAACAG, GTATGAGAGTAATGGTTACG, TATGAACTGTAGACAGTCAG and CTAATTACTCTACCTACCAT, which resulted in a 437 bp deletion beginning at Chromosome 1 position 36,889,104 bp and ending after 36,889,540 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355789 (exon 2) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early truncation 1 amino acids later. (J:188991)