This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAACAAACTCAGCCCATTAG and GAAGCTACCTGCAATCTGGA, which resulted in a 487 bp deletion beginning at Chromosome 8 position 79,719,428 bp and ending after 79,719,914 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000419942 (exon 3) and 396 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 5 amino acids later. (J:188991)