Togaram1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTACTGCCAGATAAAAGAA and TTGAGCATAAGTCTACATGT, which resulted in a 542 bp deletion beginning at Chromosome 12 position 64,976,475 bp and ending after 64,977,016 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000531940 (exon 2) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 684 and early truncation 21 amino acids later. (J:188991)