This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGAATCAAAAAGGGTAGA and CCAGTTGTTTCAAGTGTTTA, which resulted in a 414 bp deletion beginning at Chromosome 11 position 78,262,661 bp and ending after 78,263,074 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295751 (exon 2) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 60 amino acids later. (J:188991)