Kctd11^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCGCTTTGTGCGCCACTGA and CCATGCTGGGGGCCATGTTT, which resulted in a 697 bp deletion beginning at Chromosome 11 position 69,879,502 bp and ending after 69,880,198 bp (GRCm38/mm10). This mutation deletes 697 bp of ENSMUSE00000354980 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 103 amino acids later by read-through into the 3-prime UTR. (J:188991)