This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCCTACATAACAGCTTCCAG, AAGGCTAGATGGTCAGAAAT, CTAGTAAGATATATGGAGGG and GGAATTGCAATTTCTGTCTT, which resulted in a 288 bp deletion beginning at Chromosome 7 position 101,138,935 bp and ending after 101,139,222 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209356 (exon 3) and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 9 amino acids later. (J:188991)