This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTCAGGTCCTTGCATACC and GGTGAATCAAACATCCGTTC, which resulted in a 1756 bp deletion beginning at Chromosome 18 position 5,213,148 bp and ending after 5,214,903 bp (GRCm38/mm10). This mutation deletes 1756 bp of (ENSMUSE00000343297) (exon 4) and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 21 amino acids later. (J:188991)