This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCATGCGGTCTATGGATA and CGCACCTCAAGTCACACCTG, which resulted in a 444 bp deletion beginning at Chromosome 10 position 80,576,763 bp and ending after 80,577,206 bp (GRCm38/mm10). This mutation deletes 444 bp from (ENSMUSE00000307925) (exon 1)including the Kozak sequence and ATG start and leaving the final 16 bp of exon 1 and splice donor. (J:188991)