This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGACACAAACGCACTGA and GTTGCTGTGAACATCCCCTG, which resulted in a 2414 bp deletion beginning at Chromosome 7 position 126,585,381 bp and ending after 126,587,794 bp (GRCm38/mm10). This mutation deletes 2414 bp of (ENSMUSE00000349153) (exon 2) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 4 amino acids later. (J:188991)