This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CGGACGTAAAACCAACCCCG, TCACTGCCCAGATACAGCCG, GATGGTCAACGGGAATTAGG and TGAACCTTCCCAGAGCACAG, which resulted in a 428 bp deletion beginning at Chromosome 8 position 122,440,127 bp and ending after 122,440,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215074 (exon 2) and 357 bp of flanking intronic sequence including the splice acceptor and donor. This exon deletion is predicted to cause a change of amino acid sequence after residue 24 and early truncation 9 amino acids later. In addition, there are 2 smaller intronic deletions before the 428 bp deletion, neither of which should alter the results of the exon deletion: a 16 bp deletion (CAACCCCGTGGCTTTG) and a single bp (T) deletion that are 71 bp and 15 bp before the 428 bp deletion, respectively. (J:188991)