Wdr6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGTGGACCCTGAGACC and AGGCGAGGGGCCTGATTTAC, which resulted in a 2,470 bp deletion beginning at Chromosome 9 position 108,574,104 bp and ending after 108,576,573 bp (GRCm38/mm10). This mutation deletes 2,470 bp from ENSMUSE00000240681 (exon 2) and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 31 amino acids later. (J:188991)