Cabp2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGAAGACTGTGGGAACAG, GTGCGCTGTTCCAAACGCCC, GACACAGAAAGAGGGTGCCG and TTGTTATTAAAGGGAGAGCA, which resulted in a 954 bp deletion beginning at Chromosome 19 position 4,084,827 bp and ending after 4,085,780 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145610 and ENSMUSE00000145606 (exon 2,3) and 788 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 12 amino acids later. (J:188991)