This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGGCATTGGAATGTGAAA and GTTTAGCAGGAAAGGCACTG, which resulted in a 951 bp deletion beginning at Chromosome X position 106,084,876 bp and ending after 106,085,826 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000378424 (exon 3) and 461 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 2 amino acids later. (J:188991)