This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGCGTCACTTACTAACT, GTTTTATCACAATTCCTAAG, TGAGGGCGTCACTTACTAAC and GGGAGCAGCCATCATCCAGC, which resulted in a 222 bp deletion beginning at Chromosome 15 position 57,995,181 bp and ending after 57,995,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000867629 (exon 3) and 97 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 216 and early truncation 24 amino acids later. (J:188991)