Dhx38^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAAGGGTCAAAACCACCG and ACAGGAGCTGAGGTGAACCT, which resulted in a 580 bp deletion beginning at Chromosome 8 position 109,561,818 bp and ending after 109,562,397 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000325435 (exon 3) and 392 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 2 amino acids later. (J:188991)