Zfp512^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ACACAATTCCTCTTACACCC, GAAGATCTAATGGTTTCTGA, TTGTGTAAAACTATGAAGAC and GTTTATCAGTAGTGAGGTGA, which resulted in a 688 bp deletion beginning at Chromosome 5 position 31,465,168 bp and ending after 31,465,855 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000513436 (exon 3) and 500 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 3 amino acids later. (J:188991)