This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGCCAATGCCCGGGGAG and GGAAGCACCCAGGAGAAGTT, which resulted in a 263 bp deletion beginning at Chromosome 1 position 172,632,616 bp and ending after 172,632,878 bp (GRCm38/mm10). This mutation creates an internal deletion of 263 bp in ENSMUSE00000160363 (exon 1) resulting in a frame shift that is predicted to cause a change of amino acid sequence after residue 2 and early truncation 33 amino acids later. (J:188991)